anquangraham9358 anquangraham9358
  • 10-01-2024
  • Social Studies
contestada

Reactions that seem automatic, or which don't require much thought are called ______?
1) instinctive reactions
2) reflex actions
3) unconscious responses
4) spontaneous behaviors

Respuesta :

Otras preguntas

поМОГИТЕЕЕЕЕЕ ДАЮ 20 БАЛОООООООВ
Una oblea rectangular de silicio puro, con resistividad ρ= 2 300 Ωm, mide 2.00 cm por 3.00 cm por 0.010 cm. Encuentre la resistencia máxima de esta oblea rectan
4. How do ocean currents affect the temperature?​
can someone help me figure out how to solve this problem?
5. You have just read "Why Young Adults Are Taking a More Mindful Approach to Social Media" by Jessica Matlin. What do the interviews with young people suggest
Which claim statement is best illustrated by Source D?
Calculate the difference and enter below. -4 + (-4)
PLS HELP URGENT A moon orbits a planet as shown above. The moon has a mass 0.66 x 1022 kg and the gravitational field strength at distance R is 0.0012 N/kg. Wha
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
PLEASE HELP!! answer the following questions in Spanish. Make sure to conjugate each verb in bold correctly when responding. Be creative and keep in mind our ob