Use the genetic code to describe the sequence of amino acids that would be translated from the DNA sequence below. The strand below is the template strand. This DNA segment contains the beginning of the open reading frame.
5'AATGTGTTAAGACGTGCAGTACATT 3'
a. What is the mRNA sequence?
b. What is the sequence of amino acids translated?

Respuesta :