UnknownEternity
UnknownEternity UnknownEternity
  • 12-12-2019
  • Biology
contestada

during what process do alleles undergo segregation?

A) DNA replication
B) Mitosis
C) Meiosis
D) Transcription

Respuesta :

Аноним Аноним
  • 12-12-2019

Answer:

C) Meiosis

Explanation:

Alleles undergo segregation during the process of meiosis.

Answer Link

Otras preguntas

plssss help me ill give brainly
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Read the excerpt then in at least 200 words, discuss the form of this excerpt from A Midsummer Night's Dream. How do literary devices such as rhyme, meter, and
ILL GIVE YOU BRAINLEST!!
It takes Taylor hour to make of a batch of cookies. About how long will it take him to make 8 batches? A. 1.1 hours B. 3.6 hours C. 5.4 hours D. 7.2 hours
What is a rule you can use to predict the shape of a molecule based on the number of atoms and line electron pairs (i.e., substituents) around a central atom?
The Nile allowed civilizations in Nubia and Egypt to: .............
Write (4,0) and (0,6) in standard form
were the Cherokees successful adapt to American settlers
Please look at the photo and solve please I need help