jennamoltke35 jennamoltke35

12-03-2020
Mathematics

contestada

can someone pls help me find this ASAP!

can someone pls help me find this ASAP class=

Respuesta :

elsaunicorn2112 elsaunicorn2112

12-03-2020

I would think it would be 6 units. This is because if you count the squares the longer base goes around, it is equal to 6.

Answer Link

Otras preguntas

What is the y-intercept of the function f(x) = -2/9+1/3 ?

How many square roots does the number 20 have 0 1 or 2

suppose your sister is coming home for dashain write a letter to her suggesting advesing and persuading her for her save journey in the critical period of Coron

Read the description of how ancient metalworkers improved their iron. Then identify the solute and solvent by filling in the blanks. In steel, the solvent is

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

What is the simple subject? * O snow and ice O kids and adults O night Othey

state the set of multiples of 14 between 7 and 84 inclusive

What is the length of AC? if A is -8, B is -4, C is 5, D is 8

A metronome uses an inverted pendulum rod to control tempo. A weight can be slid up the pendulum rod to decrease tempo, or down the pendulum rod to increase tem

Describe the controversy that led to an individual cutting off the right foot from instes statue