sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

I need help with this please

Haida were know as warriors

Juan ran the lemonade stand for 3 more days

Why did the Puritans migrate to America? gold mines religious freedom owning plantations establishing industry

Why is project management so important in any field?

please solve this question..

The written, organized, and compiled form of the criminal laws of a jurisdiction Tort Code O Family Code O Penal Code O All of the above

Simplify 7x^2 + 3 - 5(x^2-4)

is the product of a positive number and a negative number a positive

what is the function in a cell of the carbon compounds lipids