itisme28
itisme28 itisme28
  • 12-11-2021
  • Mathematics
contestada

help algebra 2 look at all the pictures please multiple choice

help algebra 2 look at all the pictures please multiple choice class=
help algebra 2 look at all the pictures please multiple choice class=
help algebra 2 look at all the pictures please multiple choice class=
help algebra 2 look at all the pictures please multiple choice class=
help algebra 2 look at all the pictures please multiple choice class=

Respuesta :

Аноним Аноним
  • 02-02-2022

Relation given:-

  • {(-2,5),(-1,3),(0,-1),(1,-3),(2,-5),(3,-7)}

Inverse

  • {(5,-2),(3,-1),(-1,0),(-3,1),(-5,2),(-7,3)}

#2

  • f(x)=2x-3

Let it be y

[tex]\\ \tt\hookrightarrow y=2x-3[/tex]

[tex]\\ \tt\hookrightarrow 2x=y+3[/tex]

[tex]\\ \tt\hookrightarrow x=y+3/2[/tex]

Write in terms of x

[tex]\\ \tt\hookrightarrow f^{-1}(x)=\dfrac{x+3}{2}[/tex]

Answer Link

Otras preguntas

what is the best ingredient of a PB&J?
Help please and explain
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
Free Choice Research Paper : You will choose one of the Post-WW1 nationalism movements covered in chapter 25 of our text--- Choices are The Middle East, A
Mrs. Drilon’s electric meter reading last month was 1023, and her present electric meter reading is 1053. What is her electric consumption?
Work out the perimeter of this semicircle.Take it to be 3.142 and write down all of the digits given by your calculator.18 cm give your answer in cm​
can someone help me? please
Explain the different ways you can name an angle. What are the different names for this angle?
Contrast mechanical and chemical digestion.
Is this a phrase until the sun comes up