kittencatdawg4123 kittencatdawg4123

12-11-2021
Health

contestada

the wall of the eye has three layers. the outermost fibrous layer is made up of the opaque white sclera and the transparent __________.

Respuesta :

tram3664 tram3664

12-11-2021

Answer:

palpebrae

Explanation:

have a wonderful day!! :)

Answer Link

Otras preguntas

Need an answer, all are appreciated

Please answer please

Laura takes very good care of her vehicles. She owns a blue van and a red truck. Although she bought them both new, she has owned the truck for years longer tha

assume that women's heights are normally distributed with a mean of 63.6 inches and a standard deviation of 2.5 inches. find the height of a woman who is at the

Milo Company uses the percent-of-sales method to estimate uncollectibles. Net credit sales for the current year amount to $ 150 comma 000, and management esti

You have been asked to create an authentication security plan for your company. Which of the following components would you incorporate to ensure your company i

In order for a eukaryotic gene to be engineered into a bacterial colony to be expressed, what must beincluded in addition to the coding exons of the gene?A) the

LCM or 9/50 and 11/20

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

Find g(x), where g(x) is the translation 8 units right of f(x)=|x|. Write your answer in the form a|x–h|+k, where a, h, and k are integers.