jeremybellamy jeremybellamy

11-04-2022
Mathematics

contestada

Which value in the set {5, 6, 7, 8, 9} is a solution of the equation 20 - f = 13 ? Show your work.

Respuesta :

igotyou10 igotyou10

11-04-2022

20-f= 13
-f= 13-20
-f= -7
f=7

Answer Link

Otras preguntas

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

purpose for National Benchmark Tests

If a woman who is heterozygous for type B Blood, has a baby with a man who is heterozygous for type B blood, what are they chances their baby could have type O

Explain why the side shoots grow when the terminal buds are removed.

The Miller family likes to petal along the north River. 1. They paddled the same distance each day throughout the course of three days, traveling a total of 14

Please help. Will give Brainliest!!

pls help me. will give brainliest if correct!!

76.0835 rounded to the nearest ten thousandth?

The price of a watch was increased by 20% to £162. What was the price before the increase?

The field of operations management is shaped by advances in which of the following fields?