dschlutt dschlutt

12-09-2017
Mathematics

contestada

Write the sum of the numbers as the product of their GCF and another sum. 32+20

Respuesta :

Аноним Аноним

15-09-2017

32 = 2*2*2*2*2
20 = 2*2 *5

you only have a pair of 2 in common, so 4 is your GCF

Answer Link

Otras preguntas

The sum of three consecutive numbers is 576. What is the 2nd number?

[_______________] technologies are those in use at the present time PLEASE HELP

Transcribe then translate the following TACCTGTTAAGCTACAAAATT Answer Choices: A:Met-Ser-Met-Phe-Asp Acid-Stop B:Met-Asp Acid- Asp-Ser-Met-Phe-Stop C:Met-Phe-As

Answer each question with Ser or ESTAR. Remember full sentences 1. Dónde estás ahora?

A rectangular garden has a length that is modeled by the expression 2x - 7 and a width of 3x^2+4x. Part A:What is the area of the garden?(Hint- Area of a rectan

What is two 2/3÷1 1/6

For each sequence of DNA is shown. Write the complementary RNA sequence underneath the letters, thenuse the codon chart to determine the amino acid sequence:DNA

Question 21 What are the four types of paintings made popular during the Song Dynasty in China?

Which document was the focus of this presentation?

What is the slope that passes through the points (5, -11) and (-9, 17)?