DoctorC DoctorC
  • 10-09-2015
  • Mathematics
contestada

247x82 using an area model

Respuesta :

nssamra87
nssamra87 nssamra87
  • 10-09-2015
do 247x82 = 20254 :)
Answer Link

Otras preguntas

Why was Pope Gregory called “the Great"?
I need the answer ASAP !!! Pls
2. Dwayne scored 55 points in the last basketball game, which is 10 points more than his previous personal best. Lebron scored 15 points more than Chris in the
What is the equation of the line that is parallel to the line y = 3x - 4 and passes through the point (4, -2)? A. Y= 3x + 2 B. y= 3x - 14 O C. --}x D. y = 3x +
uegvgktggjyftsedr56975efuedfuytgbv PLEASE HELP ME OUT!\
Question How many solutions does the system of nonlinear equations graphed below have?
Every year Mary invests $2000 in a savings account that earns interest at 10% per annum. Find the value of her investment on the twelfth anniversary of her firs
Please help, thank you :) Music for ____ was often known instrumental music, or music without words. A) masses B) ballroom dances C) church services D) festival
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
How does cultural views that exists may affect relationship negatively